====== Explanation of the generation times ====== ^ Reference Genome ^ Neverword ^ Min. num. of mismatches ^ Generation time
(min : sec : msec) ^ | Homo sapiens
(GRCh37.64 ENSEMBL release) | TGATCGTAATCGTCGCGACA | 4 | 4:36:241 | | | GCAACCGTTCACGTGTTAGA | 3 | 1:08:592 | | | CTGAACGATTGATGCTCGAC | 3 | 1:08:560 | | Arabidopsis thaliana
(NC_003070.9, NC_003071.7,
NC_003074.8, NC_003075.7, NC_003076.8)| TCGGTGTACGGTAATCACCA | 4 | 0:01:987 | | | CTGGTCGAAGTACGCATATC | 4 | 0:02:275 | | | CTTGAGTGCAACAGCGTATC | 4 | 0:01:989 | | Mycobacterium tuberculosis
(NC_000962.2) | GGATTGCCCCTTAGACTAGA | 7 | 0:02:053 | | | CGTGTCTCCAATAAGTGAGC | 5 | 0:00:084 | | |CAGCTTAGGCTATCATCGAG | 5 | 0:00:175 | Results have been obtained by running three times //keeSeek// and specifying the parameters “-a 5:5:5:5 -R 1-K 3000 ”. The first parameter allows to specify the nucleotides composition, namely 5 A, 5 C, 5 G, and 5 T, and to obtain ordered permutations of 20-mers. The second parameter tells //keeSeek// to create a random seed and use it to prepare a random mapping for reshuffling the permutations; in this way the order among permutations is preserved but an increased variability of codes is ensured. Finally, “-K 3000” is used to limit the computation to the first 3000 results. Candidates that pass the filters are evaluated in blocks.